pipid frog (Xenopus tropicalis) cDNA Library Information

Information for 66 libraries (by tissue)


   1. NICHD_XGC_tropBone1


   2. NIH_XGC_tropBrn1
   3. NIH_XGC_tropBrn2
   4. NIH_XGC_tropBrn3
   5. NIH_XGC_tropBrn4


   6. Wellcome/CRC pCS107 tropicalis egg


   7. NICHD_XGC_Emb5
   8. NICHD_XGC_Emb6
   9. NICHD_XGC_Emb7
   10. NICHD_XGC_Emb8
   11. NIH_XGC_tropGas5
   12. NIH_XGC_tropGas6
   13. NIH_XGC_tropGas7
   14. NIH_XGC_tropMet10
   15. NIH_XGC_tropMet2
   16. NIH_XGC_tropMet3
   17. NIH_XGC_tropMet4
   18. NIH_XGC_tropMet5
   19. NIH_XGC_tropMet6
   20. NIH_XGC_tropMet7
   21. NIH_XGC_tropMet8
   22. NIH_XGC_tropMet9
   23. NIH_XGC_tropNeu5
   24. NIH_XGC_tropTad5
   25. Wellcome/CRC pCS107 tropicalis st.10-12
   26. XtSt10-30


   27. NICHD_XGC_tropEye1

fat body

   28. NIH_XGC_tropFat1


   29. NIH_XGC_1
   30. NIH_XGC_2


   31. NICHD_XGC_tropGut_m


   32. NIH_XGC_tropHrt1


   33. NIH_XGC_tropInt1


   34. NIH_XGC_tropKid1


   35. NICHD_XGC_tropLimb_m


   36. NIH_XGC_tropLiv1


   37. NIH_XGC_tropLun1


   38. NIH_XGC_10
   39. NIH_XGC_13
   40. NIH_XGC_14
   41. NIH_XGC_5
   42. NIH_XGC_6
   43. NIH_XGC_9


   44. NIH_XGC_tropSkeMus1


   45. NIH_XGC_tropOva1


   46. NIH_XGC_tropOvi1


   47. NICHD_XGC_tropPanc1


   48. NIH_XGC_tropSki1

small intestine

   49. NICHD_XGC_tropInt_54
   50. NICHD_XGC_tropInt_60
   51. NICHD_XGC_tropInt_62
   52. NICHD_XGC_tropInt_63
   53. NICHD_XGC_tropInt_66


   54. NICHD_XGC_tropSp1
   55. NIH_XGC_tropSpl1


   56. NIH_XGC_tropSto1


   57. NICHD_XGC_tropTail_m


   58. NICHD_XGC_tropTe1
   59. NIH_XGC_tropTe3
   60. NIH_XGC_tropTe4
   61. NIH_XGC_tropTe5
   62. NIH_XGC_tropTe6


   63. NICHD_XGC_tropThy1

whole body

   64. NICHD_XGC_Swb1
   65. NICHD_XGC_Swb1N
   66. NICHD_XGC_trop_25


Name: NICHD_XGC_tropBone1
Library ID: 2432
Organism: Xenopus tropicalis
Strain: TGA IC
Age: 0
Stage: adult
Organ: bone
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.


Name: NIH_XGC_tropBrn1
Library ID: 2238
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: whole brain
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from total RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1811 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_tropBrn2
Library ID: 2248
Organism: Xenopus tropicalis
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: whole brain
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 0.5-1.5 kb size fraction (additional size fractions contained in the NIH_XGC_tropBrn3 and Brn4 libraries). Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropBrn3
Library ID: 2247
Organism: Xenopus tropicalis
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: whole brain
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 1.5-2 kb size fraction (additional size fractions contained in the NIH_XGC_tropBrn2 and Brn4 libraries). Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropBrn4
Library ID: 2246
Organism: Xenopus tropicalis
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: whole brain
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 2-3 kb size fraction (additional size fractions contained in the NIH_XGC_tropBrn2 and Brn3 libraries). Library constructed at the DOE Joint Genome Institute.

Wellcome/CRC pCS107 tropicalis egg

Name: Wellcome/CRC pCS107 tropicalis egg
Library ID: 1705
Organism: Xenopus tropicalis
Age: 0
Organ: egg
Host: GeneHogs DH10B
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Average insert size 1.5 kb, range 0.5-4 kb. Library constructed by A. Zorn and J. Mason (Wellcome/CRC Institute).


Name: NICHD_XGC_Emb5
Library ID: 1803
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: gastrula
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.0 kb. Constructed by Invitrogen. Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_Emb6
Library ID: 1804
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: neurula
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Invitrogen. Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_Emb7
Library ID: 1805
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: tailbud
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Invitrogen. Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_Emb8
Library ID: 1806
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: tadpole
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Invitrogen. Note: this is a Xenopus Gene Collection library.


Name: NIH_XGC_tropGas5
Library ID: 2228
Organism: Xenopus tropicalis
Strain: Nigerian 3rd generation inbred
Age: 0
Stage: embryo
Organ: embryo
Tissue: gastrula (stage 10-13) and neurula (stage 15-18)
Host: TOP10
Vector: pCS22+
Vector type: plasmid
Insert digest: 5' PstI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'-GAGAGAGAGAGAGCTCT(20)V-3'). After ligation of PstI adapters and XhoI and PstI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into PstI/XhoI-digested pCS22+. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Jisong Peng and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_tropGas6
Library ID: 2227
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Age: 0
Stage: embryo
Organ: embryo
Tissue: gastrula (stage 10-13)
Host: TOP10
Vector: pCS22+
Vector type: plasmid
Insert digest: 5' PstI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'-GAGAGAGAGAGAGCTCT(20)V-3'). After ligation of PstI adapters and XhoI and PstI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into PstI/XhoI-digested pCS22+. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Jisong Peng and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_tropGas7
Library ID: 2222
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: gastrula (stage 10.5-12.5)
Host: ElectroTen-Blue
Vector: pCS108
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using poly A RNA and oligo dT primers (Invitrogen SuperScript Plasmid System for cDNA Synthesis and Cloning). After second-strand synthesis, cDNA was size-fractionated on a sepharose 4B-CL 30 cm column and directionally cloned into pCS108 (http://mcb.berkeley.edu/labs/harland/pages/plasmids.html). Library constructed by Russell B. Fletcher in R. Harland's laboratory (University of California, Berkeley, Dept of Molecular and Cell Biology).


Name: NIH_XGC_tropMet10
Library ID: 2369
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic, stage 64
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis (0.5-1.5 kb fraction; NIH_XGC_tropMet9 contains the 1.5-2.5 kb fraction) and ligated into SalI and NotI digested pCMV-SPORT6 vector. Primary library, not amplified. Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropMet2
Library ID: 2240
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic (stage 62)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pSPORT1 vector. This library contains the 1.5-2 kb size fraction (the 0.5-1.5 kb fraction is contained in the NIH_XGC_tropMet3 library). Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropMet3
Library ID: 2241
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic (stage 62)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pSPORT1 vector. This library contains the 0.5-1.5 kb size fraction (the 1.5-2 kb fraction is contained in the NIH_XGC_tropMet2 library).Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropMet4
Library ID: 2242
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic (stage 64)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pSPORT1 vector. Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropMet5
Library ID: 2249
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic (stage 62)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropMet6
Library ID: 2250
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic (stage 62)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropMet7
Library ID: 2366
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic, stage 62
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis (1.5-2.5 kb fraction; NIH_XGC_tropMet8 contains the 0.5-1.5 kb fraction) and ligated into SalI and NotI digested pCMV-SPORT6 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropMet8
Library ID: 2367
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic, stage 62
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis (0.5-1.5 kb fraction; NIH_XGC_tropMet7 contains the 1.5-2.5 kb fraction) and ligated into SalI and NotI digested pCMV-SPORT6 vector. Primary library, not amplified. Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropMet9
Library ID: 2368
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: metamorphic, stage 64
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis (1.5-2.5 kb fraction; NIH_XGC_tropMet10 contains the 0.5-1.5 kb fraction) and ligated into SalI and NotI digested pCMV-SPORT6 vector. Primary library, not amplified. Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropNeu5
Library ID: 2229
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Age: 0
Stage: embryo
Organ: embryo
Tissue: neurula (stage 14-18)
Host: TOP10
Vector: pCS22+
Vector type: plasmid
Insert digest: 5' PstI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'-GAGAGAGAGAGAGCTCT(20)V-3'). After ligation of PstI adapters and XhoI and PstI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into PstI/XhoI-digested pCS22+. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Jisong Peng and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_tropTad5
Library ID: 2223
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: tadpole (stage 35-41)
Host: ElectroTen-Blue
Vector: pCS108
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using poly A RNA and oligo dT primers (Invitrogen SuperScript Plasmid System for cDNA Synthesis and Cloning). After second-strand synthesis, cDNA was size-fractionated on a sepharose 4B-CL 30 cm column and directionally cloned into pCS108 (http://mcb.berkeley.edu/labs/harland/pages/plasmids.html). Library constructed by Russell B. Fletcher in R. Harland's laboratory (University of California, Berkeley, Dept of Molecular and Cell Biology).

Wellcome/CRC pCS107 tropicalis st.10-12

Name: Wellcome/CRC pCS107 tropicalis st.10-12
Library ID: 1704
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo
Host: GeneHogs DH10B
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Average insert size 1.5 kb, range 0.5-4 kb. Library constructed by A. Zorn and J. Mason (Wellcome/CRC Institute).


Name: XtSt10-30
Library ID: 2088
Organism: Xenopus tropicalis
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos, pool
Host: DH10B
Vector: pRKW2
Vector type: phagemid
Insert digest: 5' XhoI/BamHI 3'
Stop Codon Status: without
Description: 10 ug of polyA+ RNA was isolated from a mixture of embryos at stage 10, 20 and 30 and primed by oligo-dT primer: 5'-GAGAGAGAGAAGGATCC(T)16VN-3' (where V=G,A,C). 5-methyl-dCTP was used instead of dCTP in the first-strand synthesis in order to get hemimethylated cDNA. After full-length enrichment, oligo-dG tailing and normalization against itself, second-strand synthesis was carried out by priming with 5'-GAGAGAGAGACTCGAGTTAATTAAT(C)13-3'. dsDNA was digested with XhoI/BamHI and directionally cloned into the pRKW2 vector. Average insert size is 1.5 kb. Library constructed using the Carninci protocol (Genome Research 2000) by Drs. W. Wu and C. Niehrs (DKFZ, Heidelberg, Germany).


Name: NICHD_XGC_tropEye1
Library ID: 2424
Organism: Xenopus tropicalis
Age: 0
Stage: adult
Organ: eye
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.2kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.


Name: NIH_XGC_tropFat1
Library ID: 2232
Organism: Xenopus tropicalis
Age: 0
Stage: adult
Organ: fat body
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1905 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_1
Library ID: 2514
Organism: Xenopus tropicalis
Age: 0
Organ: Gastrula
Tissue: Xenopus tropicalis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.


Name: NIH_XGC_2
Library ID: 2515
Organism: Xenopus tropicalis
Age: 0
Organ: Gastrula
Tissue: Xenopus tropicalis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Center (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_tropGut_m
Library ID: 2425
Organism: Xenopus tropicalis
Strain: TGA
Age: 0
Stage: embryo
Organ: gut
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.


Name: NIH_XGC_tropHrt1
Library ID: 2233
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Age: 0
Stage: adult
Organ: heart
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1678 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_tropInt1
Library ID: 2214
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: both
Age: 0
Stage: adult
Organ: intestine
Tissue: normal intestine, 14 pooled
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Library prepared from 5 ug of poly A+ RNA by oligo-dT priming [5'-GA(10)CTAGTCTCGAGT(18)-3'] and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and XhoI digestion, the cDNA was size-selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1 kb were ligated into EcoRI/XhoI digested pCS107 vector. Average insert size is 2.1 kb. The original library contained 9E4 recombinants. Reference: Current Genomics 4, 635-644. Use sp6 to obtain 5' end sequence, and t7 or t3 to obtain 3' end sequence. Library constructed by Bruce Blumberg (University of California, Irvine, Dept of Developmental and Cell Biology).


Name: NIH_XGC_tropKid1
Library ID: 2202
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: both
Age: 0
Stage: adult
Organ: kidney
Tissue: normal kidney, pool of 14
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'-GAGAGAGAGAGAGAGAGAGACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Reference for library construction: Current Genomics 4, 635-644. Primers for sequencing: t3 or t7 for 3' end, sp6 for 5' end. Library constructed by Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine). Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_tropLimb_m
Library ID: 2426
Organism: Xenopus tropicalis
Strain: TGA
Age: 0
Stage: embryo
Organ: limb
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.


Name: NIH_XGC_tropLiv1
Library ID: 2226
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: male
Age: 0
Stage: adult
Organ: liver
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared by oligo-dT priming (5'-GAGAGAGAGAGAGAGAGAGACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_tropLun1
Library ID: 2230
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Age: 0
Stage: adult
Organ: lung
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1783 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_10
Library ID: 2519
Organism: Xenopus tropicalis
Gender: both
Age: 0
Stage: mixed
Organ: mixed
Tissue: Xenopus tropicalis neurula - M and F, embryos; ovary - F, adult
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_XGC_13
Library ID: 2520
Organism: Xenopus tropicalis
Gender: both
Age: 0
Stage: mixed
Organ: mixed
Tissue: Xenopus tropicalis neurula, head, brain, brain whole, ovary, lung, intestine, gastrula, tailbud, oviduct, liver, testis, tadpole
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_XGC_14
Library ID: 2521
Organism: Xenopus tropicalis
Gender: both
Age: 0
Stage: mixed
Organ: mixed
Tissue: Xenopus tropicalis neurula, head, brain, brain whole, ovary, lung, intestine, gastrula, tailbud, oviduct, liver, testis, tadpole
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_XGC_5
Library ID: 2516
Organism: Xenopus tropicalis
Age: 0
Organ: mixed
Tissue: Xenopus tropicalis gastrula, tailbud
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_XGC_6
Library ID: 2517
Organism: Xenopus tropicalis
Age: 0
Organ: mixed
Tissue: Xenopus tropicalis gastrula, tailbud
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_XGC_9
Library ID: 2518
Organism: Xenopus tropicalis
Gender: both
Age: 0
Stage: mixed
Organ: mixed
Tissue: Xenopus tropicalis neurula - M and F, embryos; ovary - F, adult
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_XGC_tropSkeMus1
Library ID: 2215
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: both
Age: 0
Stage: adult
Organ: muscle
Tissue: skeletal muscle, pooled from 14 individuals
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Library prepared from 5 ug of poly A+ RNA by oligo-dT priming [5'-ACTAGTGCGGCCGCCTAGGCCTCGAGT(18)-3'] and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and XhoI digestion, the cDNA was size-selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1 kb were ligated into EcoRI/XhoI digested pCS107 vector. Average insert size is 1.5 kb. The original library contained 1E5 recombinants. Reference: Current Genomics 4, 635-644. Use sp6 to obtain 5' end sequence, and t7 or t3 to obtain 3' end sequence. Library constructed by Bruce Blumberg (University of California, Irvine, Dept of Developmental and Cell Biology).


Name: NIH_XGC_tropOva1
Library ID: 2234
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: female
Age: 0
Stage: adult
Organ: ovary
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1408 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_tropOvi1
Library ID: 2235
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: female
Age: 0
Stage: adult
Organ: oviduct
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1745 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NICHD_XGC_tropPanc1
Library ID: 2427
Organism: Xenopus tropicalis
Strain: Nigerian
Age: 0
Stage: adult
Organ: pancreas
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.


Name: NIH_XGC_tropSki1
Library ID: 2236
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: both
Age: 0
Stage: adult
Organ: skin
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1562 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NICHD_XGC_tropInt_54
Library ID: 2436
Organism: Xenopus tropicalis
Strain: wild type
Age: 0
Stage: metamorphic
Organ: small intestine
Tissue: small intestine, 6 pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_tropInt_60
Library ID: 2437
Organism: Xenopus tropicalis
Strain: wild type
Age: 0
Stage: metamorphic
Organ: small intestine
Tissue: small intestine, 5 pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_tropInt_62
Library ID: 2438
Organism: Xenopus tropicalis
Strain: wild type
Age: 0
Stage: metamorphic
Organ: small intestine
Tissue: small intestine, 5 pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_tropInt_63
Library ID: 2439
Organism: Xenopus tropicalis
Strain: wild type
Age: 0
Stage: metamorphic
Organ: small intestine
Tissue: small intestine, 7 pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 2.1 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_tropInt_66
Library ID: 2440
Organism: Xenopus tropicalis
Strain: wild type
Age: 0
Stage: metamorphic
Organ: small intestine
Tissue: small intestine, 5 pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_tropSp1
Library ID: 2429
Organism: Xenopus tropicalis
Age: 0
Stage: adult
Organ: spleen
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.


Name: NIH_XGC_tropSpl1
Library ID: 2237
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: both
Age: 0
Stage: adult
Organ: spleen
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from total RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1610 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NIH_XGC_tropSto1
Library ID: 2231
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Age: 0
Stage: adult
Organ: stomach
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 978 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NICHD_XGC_tropTail_m
Library ID: 2433
Organism: Xenopus tropicalis
Strain: TGA
Age: 0
Stage: embryo
Organ: tail
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.


Name: NICHD_XGC_tropTe1
Library ID: 2430
Organism: Xenopus tropicalis
Strain: TGA IC
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.


Name: NIH_XGC_tropTe3
Library ID: 2243
Organism: Xenopus tropicalis
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 0.5-1.5 kb size fraction (additional size fractions contained in the NIH_XGC_tropTe4 and Te5 libraries). Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropTe4
Library ID: 2244
Organism: Xenopus tropicalis
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 1.5-2 kb size fraction (additional size fractions contained in the NIH_XGC_tropTe3 and Te5 libraries). Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropTe5
Library ID: 2245
Organism: Xenopus tropicalis
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 2-3 kb size fraction (additional size fractions contained in the NIH_XGC_tropTe3 and Te4 libraries). Library constructed at the DOE Joint Genome Institute.


Name: NIH_XGC_tropTe6
Library ID: 2239
Organism: Xenopus tropicalis
Strain: Nigerian 6th generation inbred
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The library was prepared from total RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1364 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).


Name: NICHD_XGC_tropThy1
Library ID: 2431
Organism: Xenopus tropicalis
Age: 0
Stage: adult
Organ: thymus
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.


Name: NICHD_XGC_Swb1
Library ID: 2053
Organism: Xenopus tropicalis
Gender: male
Age: 0
Stage: adult
Organ: whole body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Bulk tissue was collected from a whole 10 month old male from the F6 strain. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for >1.5 kb fragments for an average insert size of 1.92 kb. A normalized version of this library is also available (NICHD_XGC_Swb1N). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Xenopus Gene Collection library.


Library ID: 2049
Organism: Xenopus tropicalis
Gender: male
Age: 0
Stage: adult
Organ: whole body
Tissue: Whole body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Bulk tissue was collected from a whole 10 month old male from the F6 strain. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for >1.5 kb fragments for an average insert size of 1.92 kb. Library was normalized to Cot5 with a 180-fold reduction of actin. A non-normalized version of this library is also available (NICHD_XGC_Swb1). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Xenopus Gene Collection library.


Name: NICHD_XGC_trop_25
Library ID: 2428
Organism: Xenopus tropicalis
Strain: PopA
Age: 0
Stage: embryo
Organ: whole body
Host: DH10B TonA
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.