• You may search using specific matches to numbers or text, or you may indicate a range. For example, enter "100-115" to search for all gene IDs 100 through 115 inclusive.

• You may also enter multiple words, numbers or terms separated by spaces (or semicolons or commas), and all of your terms will be searched for if you are using the OR option.

• If you are using the AND option, then all of your search criteria must be met.

• If you copy multiple terms from another document, and those terms are on separate lines (such as in an Excel spreadsheet), then when you paste those terms into the search box they will automatically be separated by spaces, which is fine.

• Ranges may be combined with other ranges, or with single-string searches, for example: 200-210; 214, 220

• Ranges are only valid if the left number is less than the right number. ("100-105" is valid. "105-100" is not a valid range and will be searched as a regular string.)

• Valid alternative forms of ranges are: "100-105"; "100 - 105"; "100 to 105"; "100 through 105"; "100 thru 105" [do NOT include quotes]

• To search for a multi-word phrase, put it in quotes (for example: "domain containing kinase")

• If more than one row is returned in the results table, the column headers are clickable links which can be clicked in order to cause the results table to be sorted by that column. Click once on a column to sort the results alphabetically by that column. Click a second time on the same column to sort the results in reverse alphabetical order.

---

Use the search feature above to search by various characteristics, including gene symbol, gene ID, clone name, clone ID, library name, vector name.
To better understand these terms, you may browse by:
Gene Symbol • Clone Name • Clone ID • Gene ID • Library Name • Vector Name • Species

1. pCS2+

pCS2+

Name: pCS2+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Max Planck Institute/Rupp
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: Expression vector, T7 may be mutated. NOTES: Vector size 4095 bp. pCS2+ is an expression vector primarily designed for expressing proteins in Xenopus embryos from either injected RNA or DNA, pCS2+ is also useful for high-level transient expression in a wide variety of mammalian and avian cells. It is also functional in zebrafish embryos (as DNA or RNA) and it can be used for invitro transcription/translation. pCS2+ contains a strong enhancer/promoter (simian CMV 1E94) followed by a polylinker and the SV40 late polyadenylation site. An sp6 promoter is present in the 5' UTR, allowing in vitro RNA synthesis of sequences cloned into the polylinker. A T7 promoter in reverse orientation between the polylinker and the SV40 polyA site for probe synthesis, as well as a second polylinker after the SV40 polyA site provide several sites to linearize the vector for Sp6 RNA transcription. Vector backbone is pBluescript II KS+ and includes the amp gene and an f1 origin for single stranded DNA.
Sequencing Primers: t7, sp6
Polylinker Sequence:
cgccattctgcctggggacgtcggagcaagcttgatttaggtgacactat
agaatacaagctacttgttctttttgcaggatcccatcgattcgaattca
aggcctctcgagcctctagaactatagtgagtcgtattacgtagatcgag
a
Full Sequence:

 

Lafmid BA	mixed	None	pAD-GAL4	pAMP1
pAMP10	pBC SK+	pBK-CMV	pBluescribe (modified)	pBluescript (modified)
pBluescript II KS+	pBluescript II SK+	pBluescript KS+	pBluescript SK+	pBluescript SK-
pBluescript-FL	pBluescriptR	pBSRN3	pCDNA3	pcDNA3.1
pcDNA3.1(-)	pcDNA3.1Zeo	pcDNAI	pCDNAII	pCI-neo (updated)
pCMV-SPORT	pCMV-SPORT2	pCMV-SPORT4	pCMV-SPORT6	pCMV-SPORT6.1
pCMV-SPORT6.ccdb	pCR-BluntII-TOPO	pCR-XL-TOPO	pCR2.1-TOPO	pCR3.1
pCR4-TOPO	pCR4Blunt-TOPO	pCS105	pCS107	pCS108
pCS111	pCS2+	pCS22+	pCS2G	pDeliver1.1
pDNR-Dual	pDNR-LIB	pDNR-NCI	pDONR201	pDONR221
pDONR223	pDONR223.1	pDummy-amp	pDummy-chlor	pDummy-kan
pDummy-spec	pENTR/D-TOPO	pENTR201	pENTR221	pENTR223
pENTR223.1	pENTR223.1-LC	pENTR223.1-Sfi	pET-28a	pET-28b
pExpress-1	pFLC1	pGA1	pGA14	pGA15
pGA18	pGA19	pGA24	pGA4	pGA7
pGH	pMA	pME18S-FL3	pMK	pMK-U
pOTB7	pOTB7-3	pOTB7a	pPCR-Script Amp SK(+)	pRKW2
pSMART_cDNA	pSPORT1	pSPORT2	pT7T3D-PacI	pUC19
pUC19-Cam	pUC19-Kan	pUC19-Sfi	pUC57	pYO326
pYX-Asc	pZErO-1	pZERO-2	pZL-1	Uni-ZAP-XR
unknown